Can Reishi Extract be potential growth promoters for probiotics?

Task 1: Abstract 3

Literature Review 3

Task 2: Reflective Statement Error! Bookmark not defined.

References 13

Abstract

The presented research study is targeted towards conducting a comprehensive study of Probiotic Milk and Reishi extract to Enhance Gut Microbiota. In this context, the research study has provided a brief background in order to understand the terminology associated with the research study. Three primary research aims have been formulated to provide a compressive understanding of the research objectives and what question the research is trying to answer. Further, the research methodology used in this case is by way of collecting data from secondary sources which includes pieces of literature, journals, and reports for enhancing the authenticity of the presented research study. Further, the likely findings of this research study include an adequate connection between Probiotics and Reishi extract to enhance gut microbiota. In addition, based on the critical analysis of the secondary data, an optimum discussion is presented in the research study which segregates the entire dimension or elements of the study to form a valid concluding remark. Therefore, the overall Discussion will lead to offering an emerging solution for a variety of diseases faced by human beings through an effective solution.

Literature Review

Introduction

Probiotic-containing milk products have an adequate level of healthy functional-food features. Moreover, probiotics offer an extra value added to milk or dairy products that already carry an extensive level of minerals, protein, vitamins required for healthy development as well as growth especially in children and wellness and disease prevention in adults (Tillisch et al., 2013). On the other side, Reishi extracts could also be termed as Reishi mushroom which is a type of fungus with no exact health benefits. However, it carries some impact on the overall immune system and it is generally utilised for cancer, diabetes, Alzheimer disease, and various other situations. However, there is no adequate evidence that the Reishi mushroom has proven to be effective in such diseases. On contrary, it has been found that Reishi mushroom supports in decreasing stress, improving sleep, and decreasing the fatigue level within the human body. In addition, people also consume Reishi extracts for health situations like kidney or liver disease, high blood pressure, and various other associated conditions (Jin et al., 2012). Therefore, in the overall context of probiotic milk and Reishi extracts the presented research is targeted to conducting a comprehensive study of both the things for enhancing gut Microbiota. Microbiota in this context could be understood as the variety of micro-organisms which may be symbiotic, pathogenic, and commensal found in as well as the entire multi-cellular organism such as human beings (Jandhyala et al., 2015).

Aims and Objectives

The presented study aims to conduct comprehensive research on Probiotic Milk. Thus, in the context of the proposed research aim, the research objectives of the study are as follows: –

To examine the overall significance of Probiotic Milk

To critically analyse the impotence of Reishi extracts for human health and well being

To determine the connection or role of probiotic milk and Reishi extracts for enhancing gut Microbiota.

Probiotic Milk and its Significance

As per the viewpoint of Corb Aron et al. (2021), it has been examined those probiotics have gained emerging recognition due to their nutritional properties, which positively impact the health and immunity system of human beings. Furthermore, probiotics have been considered microorganisms beneficial for human beings as they provide significant vitamin and mineral nutrients to the gut system. Similar interventions by Roobab et al. (2020) focused on the potential health benefits of the probiotic-enriched dairy product such as milk in enhancing healthy and functional growth and preventing the risk of diseases in children and adults.

In contrast, the study conducted by Eslami et al. (2019) analysed that human beings who suffer from lactose intolerance should consume fermented food, such as probiotic milk and yoghurt, to digest the amount of lactose present in the small intestine of the human body. Probiotics positively influence gastrointestinal health and reduce the problems of diarrhoea and bowel syndrome, along with suppressing the mutation of Helicobacter pylori, which causes stomach cancer. However, Mu, Tavella and Luo (2018) argued that probiotic milk has emerged as the suitable probiotic carrier that enhances the gut microbiota of individuals and improves their overall immunity system. Moreover, Lactobacillus reuteri is one of the best probiotic strains, which suppresses the establishment of pathogenic microbes in the human gut system and reduces the generation of pro-inflammatory cytokines in the immune system.

Reishi Extract and its Significance

According to the study conducted by Rahman et al. (2020), it has been examined that Reishi mushroom, scientifically known as Ganoderma lucidum is a fungus that has significant benefits to cure several diseases such as cancer, cold sores and Alzheimers. Human beings consume Reishi mushrooms to upgrade their sleep cycles and immunity. It also helps reduce the human body’s fatigue levels by controlling the high blood pressure and cholesterol levels. On the other hand, Seweryn, Ziała and Gamian (2021) revealed that Reishi extract affects the white blood cells in the human body and improves the inflammatory pathway present in the white blood cells. Furthermore, it has been examined that Reishi extract has molecular natural killer cells, which are beneficial to combat cancer and infections in human beings.

In contrast to the above, Zhao et al. (2019) studied and found that there are potential health benefits of Reishi to improve the gut health of human beings as it possesses significant medicinal properties, which assists in balancing the overall immune system. Moreover, it has also been reported that the extract from the Reishi mushroom improves gut inflammation and reduces the fat tissues in the human body to enhance the balanced gut and immunity. In addition, the promotion of healthy gut bacteria enhances the gastrointestinal system in human beings and further improves their overall functionality.

Role of Probiotic Milk and Reishi Extract to Enhance Gut Microbiota

The research conducted by Hemarajata and Versalovic (2013) revealed that probiotic milk and Reishi extract rehabilitate the formation of the gut microbiome. It further improves the internal functioning of the gut microbial cells and provides benefits by reducing gut inflammation and other gastroenteric disorder phenotypes. Intestinal microbes can change the genetic articulation in the gut system of the human body, which adversely affects the overall functioning of the gastrointestinal section. Similarly, Li et al. (2021) analysed that the consumption of probiotic milk and Reishi extract significantly impact the microbiomes and alter the biochemical patterns in the gastrointestinal lumen. Furthermore, probiotic milk and Reishi extract influence the gut microbial communities and produce β-defensin and IgA, which prevents the generation of pathogens in the gut system of human beings.

On the contrary, the study conducted by La Fata, Weber and Mohajeri (2018) highlighted those strains of the probiotic Lactobacillus are beneficial in enhancing the gastroenteric barrier to maintain the immune system by reducing gut infections. On the other hand, several tools, and techniques such as metagenomic sequencing and culture-dependent methods are utilised to measure the impact of probiotic milk and Reishi extract on the functional composition of gut microbiota. Similar interventions by Novik and Savich (2020) stated that Probiotic milk and Reishi extract were considered preventive measures to re-establish the healthy creation of gut microbiota in the human body. However, future strategies with relation to probiotic milk and Reishi extract can be beneficial in preventing gastrointestinal diseases and promoting the healthy functioning of the gut microbiota in human beings.

According to the viewpoint of Li et al. (2021), the Reishi mushroom has significant medicinal properties such as hypocholesterolaemia and antimicrobial effects, which aims to reduce obesity in the human body by regulating the formation of gut microbiota. Moreover, Reishi extract and probiotic milk increase the metabolism and immunity system that helps in reducing the gastrointestinal inflammation and body fat in the gut microbiota. Reishi mushroom is one of the immunomodulatory agents that actuates the gut microbiota and improve the gastrointestinal tract’s functionality in the human body. In contrast, Jayachandran, Xiao and Xu (2017) argued that the high phenolic essence present in Reishi extract and probiotic milk results in the high antioxidant for nutrients that assists in digesting the food, which intestine enzyme and stomach are unable to digest and enhances the gut microbiota.

The requirements should be paraphrased in the result-discussion.

Overall it is about mixing Reishi with 2 bacteria probiotics.

One of the probiotic bacteria is L. paracasei MA1 and the second is L paracasei L-007.

Actually, those bacteria were analysed from 2 commercial probiotic drinks.

1 product was Yeo Organic Yoghurt, where the manufacturer claims the following bacteria inside :

Bifidobacterium, L. acidophilus and S. themophilus.

The second was Yakult with L. casei Shirota.

After I had followed the flow diagram from the probiotics project, I have found that none contained the bacteria claimed by the manufacturer.

You must add in the Discussion like don’t relay in labels from commercial yoghurts.

In the Discussion, you may add that other products from my team have found pathogenic bacteria such as staphylococcus and streptococcus, or the contamination may happen from our workflow protocol.

You may say that reishi extract and my probiotics bacteria can form a symbiosis and might be suitable to produce a food product.

You may add some laboratory difficulties during the experiment but were resolved.

Method ( ~600 words)

You may follow the flow diagram in only 600 words.

e.g. serial dilution role.

gram staining

API

16 S rRNA…

Result and Discussion (~3900 words total in one) if you chose to write Result(2100 words) separately- and Discussion (1800 words). It’s up to you!

Table 1 shows serial dilution spread plates for Yeo Yoghurt Organic

Sample 1	10⁵	10⁶	10⁷	10⁸
Replicate 1	TN	TN	TF	TF
Replicate 2	TN	95	TF	TF
Replicate 3	TN	53	TF	TF
Average	–	74	–	–

CFU/ml for 10⁶ = 74 x 10⁶x10

=74 x 10⁷=7.4 x 10⁸

Table 2 shows serial dilutions drop plates for Yeo Yoghurt

Sample 1

4 replicates

Average

–

CFU/ml for 10⁴ = 59 x 10⁴ x 100

=59 x 10⁶ =5.9 x 10⁷

For the Yakult, no countable cultures were detected after incubation; however, only three colonies were seen and analysed for Gramm staining and the 16 S rRNA sequencing.

Table 3 indicates the isolation of the probiotic organism.

Organism ID

Source

Colony nature

Gram’s reaction

Catalase

AP ID

Molecular ID

NI 2122-2

Yeo Organic

Small

Circular

Creamy white

Rod-shaped

Gram-positive

negative

Esculin

hydrolysis

positive

Lactobacillus

paracasei

Strain MA1

NI 22122-2

Yakult

Circular

convex

Rod shape in

cluster

Gram-positive

negative

Esculin

hydrolysis

positive

Lactobacillus

paracasei

Strain L-007

Probiotics Bioinformatics data

Organism ID

Blast ID

Percentage

E value

Any comments

NI 2122-1

Lactobacilus paracasei

Strain MA1

99.05

0.0

Has 99.05 similarity

NI 22122-2

Lactobacilus paracasei

Strain L-007

99.23

0.0

Has 99.23 similarity

Nanodrop results from NI 2122-1

A260 (10mm): 1.291

A260/A280 :3.26

64.6 ng/µl

Nanodrop results from NI 2122-1

A260 (10mm) : 1.817

A260/A280 :3.36

90.8 ng/µl 500bp x 20 ng

Amount of PCR product to add (ng)=

100 bs

10.000

The volume of PCR product to add(µl)= = 157.7

64.6

10.000

The volume of PCR product to add(µl)= = 157.7

98.8

Formulation assay

NI 2122-1(sample 1) cell density:0.148

NI 2122-2(sample 2) cell density:0.416

cell density required

1ml of reishi extract added

10 ml volume needs in total

sample 1 +sample 2 has mixed

How much ml of Sterile broth should I add?

0.1 x 10mL

sample 1 =1/1.48= 0.67 ml= 670 µl

1.48 OD

0.1 x 10mL

sample 2 = 1/4.16= 0.24 ml= 240 µl

4.16

670+240= 910 µl of samples

1ml of reishi extract

8.09 ml of MRS broth sterile.

total 10 ml for formulation for incubation ( 2 pictures attached about this process)

for Survival assay

NI 2122-1(sample 1) cell density:0.148

NI 2122-2(sample 2) cell density:0.416

cell density required

1ml of reishi extract added

10 ml volume needs in total

sample 1 +sample 2 has mixed

How much ml of Sterile broth should I add?

0.5 x 10mL

sample 1 =5/1.48= 3.37 ml= 3370µl

1.48 OD

0.5 x 10mL

sample 2 = 5/4.16= 1.20 ml= 1200 µl

4.16

4.570 µl of samples

1ml of reishi extract

4.43 ml of MRS broth sterile.

total 10 ml for survival keept in the frige.

These two assays show the symbiotic relation between Reishi and probiotic bacteria, and it has to paraphrase here.

The plate reader graph indicates the growth curve of samples.

The plate reader was recording cell density at 37 degrees Celsius for 36 hours.

Finally, the plate reader recorded 72 readings in total.

I don’t know why I don’t have a death phase?

	Assay	Plate	Number of colonies	Plot
Day 1	Formulation	10¯5	1 x 10⁸	8.1
	Survival	10¯5	8 x 10⁷	7.8
Day 2	Formulation	10¯5	9.1 x 10⁸		8.9
	Survival	10¯5	1.1 x 10⁸		8.1
Day 3	Formulation	10¯3	4.5 x 10⁶		6.4
	Survival	10¯5	2.0 x 10⁸		8.2

According to the CFU assay plates, there appears to be a growing tendency for the formulation on days 1 and 2 and a drop-off on day 3, whereas the survival shows a slight increase on all three days.

Can you make me the scale for CFU divided into ten? 0 to 1 be divided into ten and so on.

NI 2212-1

the ladder NI 2122-2

You may say that our lactobacillus strains have around 500 bp, shown in those pictures in legend.

Future work.

It may be something like L rhamnous gg strain may be a better probiotic combination with Reishi, or it is up to you what opinion will be chosen.

References

Corb Aron, R.A., Abid, A., Vesa, C.M., Nechifor, A.C., Behl, T., Ghitea, T.C., Munteanu, M.A., Fratila, O., Andronie-Cioara, F.L., Toma, M.M. and Bungau, S. (2021) ‘Recognising the benefits of pre-/probiotics in metabolic syndrome and type 2 diabetes mellitus considering the influence of akkermansia muciniphila as a key gut bacterium’, Microorganisms, 9(3), p. 618.

Eslami, M., Yousefi, B., Kokhaei, P., Moghadas, A.J., Moghadam, B.S., Arabkari, V. and Niazi, Z. (2019) ‘Are probiotics useful for therapy of Helicobacter pylori diseases?’, Comparative Immunology, Microbiology and Infectious Diseases, 64, pp. 99-108.

Hemarajata, P. and Versalovic, J. (2013) ‘Effects of Probiotics on Gut Microbiota: Mechanisms of Intestinal Immunomodulation and Neuromodulation’, Therapeutic Advances in Gastroenterology, 6(1), pp. 39-51.

Jandhyala, S.M. et al. (2015) ‘Role of the normal gut microbiota’, World Journal of Gastroenterology: WJG, 21(29), p. 8787.

Jayachandran, M., Xiao, J. and Xu, B. (2017) ‘A Critical Review on Health Promoting Benfits of Edible Mushroom Through Gut Microbiota’, International Journal of Molecular Sciences, 18(9), p. 1934.

Jin, X., Beguerie, J.R., Sze, D.M.Y. and Chan, G.C. (2012) ‘Ganoderma lucidum (Reishi mushroom) for cancer treatment’, Cochrane Database of Systematic Reviews, (6).

John, K. N. (2018) ‘Importance of Communication to Stakeholders in all Organisations’, International Journal of Innovation and Research in Educational Sciences, 5(5), pp. 2349-5219.

La Fata, G., Weber, P. and Mohajeri, M.H. (2018) ‘Probiotics and the gut immune system: indirect regulation’, Probiotics and Antimicrobial Proteins, 10(1), pp. 11-21.

Li, M., Yu, L., Zhao, J., Zhang, H., Chen, W., Zhai, Q. and Tian, F. (2021) ‘Role of dietary edible mushrooms in the modulation of gut microbiota’, Journal of Functional Foods, 83, p. 104538.

Li, Y., Liu, H., Qi, H., Tang, W., Zhang, C., Liu, Z., Liu, Y., Wei, X., Kong, Z., Jia, S. and Du, B. (2021) ‘Probiotic fermentation of Ganoderma lucidum fruiting body extracts promoted its immunostimulatory activity in mice with dexamethasone-induced immunosuppression’, Biomedicine & Pharmacotherapy, 141, p. 111909.

Mu, Q., Tavella, V. J. and Luo, X. M. (2018) ‘Role of Lactobacillus reuteri in Human Health and Diseases’, Frontiers in Microbiology, 9, pp. 1-17.

Novik, G. and Savich, V. (2020) ‘Beneficial microbiota. Probiotics and pharmaceutical products in functional nutrition and medicine’, Microbes and Infection, 22(1), pp. 8-18.

Rahman, M.A., Al Masud, A., Lira, N.Y. and Shakil, S. (2020) ‘Proximate analysis, phtochemical screening and antioxidant activity of different strains of Ganoderma lucidum (Reishi mushroom)’, Open Journal of Biological Sciences, 5(1), pp. 024-027.

Roobab, U., Batool, Z., Manzoor, M.F., Shabbir, M.A., Khan, M.R. and Aadil, R.M. (2020) ‘Sources, formulations, advanced delivery and health benefits of probiotics’, Current Opinion in Food Science, 32, pp. 17-28.

Seweryn, E., Ziała, A. and Gamian, A. (2021) ‘Health-promoting of polysaccharides extracted from Ganoderma lucidum’, Nutrients, 13(8), p. 2725.

Tillisch, K. et al. (2013) ‘Consumption of fermented milk product with probiotic modulates brain activity’, Gastroenterology, 144(7), pp. 1394-1401.

Zhao, C., Zhang, C., Xing, Z., Ahmad, Z., Li, J.S. and Chang, M.W. (2019) ‘Pharmacological effects of natural Ganoderma and its extracts on neurological diseases: a comprehensive review’, International Journal of Biological Macromolecules, 121, pp. 1160-1178.

Appendix

NI2122-1< CGCGAGGCGGTGCTAATACATGCAAGTCGAACGAGTTCTCGTTGATGATCGGTGCTTGCACCGAGATTCAACATGGAACGAGTGGCGGACGGGTGAGTAACACGTGGGTAACCTGCCCTTAAGTGGGGGATAACATTTGGAAACAGATGCTAATACCGCATAGATCCAAGAACCGCATGGTTCTTGGCTGAAAGATGGCGTAAGCTATCGCTTTTGGATGGACCCGCGGCGTATTAGCTAGTTGGTGAGGTAATGGCTCACCAAGGCGATGATACGTAGCCGAACTGAGAGGTTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGCAAGTCTGATGGAGCAACGCCGCGTGAGTGAAGAAGGCTTTCGGGTCGTAAAACTCTGTTGTTGGAGAAGAATGGTCGGCAGAGTAACTGTTGTCGGCGTGACGGTATCCAACCAGAAAGCCACGGCTAACTACGTGCCAGCCGCCCGGGGTAATTCAA

this picture shows Blast ID for NI 2212-1

this picture shows Blast ID for NI 2212-2

example spread plate divided in 4 to be easy to count

you may add some information in the Result what is the difference between spread plate and drop plate in serial dilutions

in my case, there no was any inhibition zone

Another case was an inhibition zone between good bacteria and pathogenic bacteria.

Assignment status: Already Solved By Our Experts
(USA, AUS, UK & CA PhD. Writers)
CLICK HERE TO GET A PROFESSIONAL WRITER TO WORK ON THIS PAPER AND OTHER SIMILAR PAPERS, GET A NON PLAGIARIZED PAPER FROM OUR EXPERTS

QUALITY: 100% ORIGINAL PAPER – NO PLAGIARISM – CUSTOM PAPER

comprehensive study of Probiotic Milk

Table of Contents

Literature Review

References

Leave a Reply Cancel reply